PROBER Tutorial

Section 2

MerMatch: mask repetitive DNA sequences in the human genome


Launch the MerMatch & Tolerance window by clicking on the 'Utilities' Menu > MerMatch / Tolerance

Press 'Load DNA sequence' that was previously saved by DAS.DNA to load in the genomic DNA sequence.

Note : The PROBER folder and files must be installed in C:\PROBER.  
(Otherwise MerMatch will output an error and will not be able to run)

In the MerMatch / Tolerance graphical interface set the Load in RAM parameter to 1 (true) if you have 1 gig of RAM available on your machine.  If your computer has less then 1 gigabyte of RAM then set Load in RAM to 0 (false).

Set the mer.match.length to 18 (default). This is the window size of nucleotides that will be matched against the human genome to determine how many times it occurs.  After matching the window against the human genome, the number of exact string matches is reported and the window is moved up by one base pair.  This cycle continues until the number of matches for each window within the DNA sequence is determined.

For example using a mer.match.length of 18 on a sequence such as this:

AGCTAGCATAGAGATCGACTAGCTACT

Will result in the following query strings to match against the human genome:

AGCTAGCATAGAGATCGA = 1
 GCTAGCATAGAGATCGAC = 2
  CTAGCATAGAGATCGACT = 4
   TAGCATAGAGATCGACTA = 1
     AGCATAGAGATCGACTAG = 1
      GCATAGAGATCGACTAGC = 1
        CATAGAGATCGACTAGCT = 5
          ATAGAGATCGACTAGCTA = 3
           TAGAGATCGACTAGCTAC = 1
             AGAGATCGACTAGCTACT = 2

Each substring has a corresponding frequency in the human genome. Set the "mer.count.cutoff" to 1 (default). This will mask any substrings that occur at a frequency > 1.

ANNTAGNNTNGAGATCGACTAGCTACT

Substrings that are repetive in the human genome (mer.count.cutoff > 1) are masked with 'N'.

Run MerMatch with the following (default) parameters:

Load in RAM: 1
mer.match.length: 18
mer.count.cutoff: 3

          

Press 'Run Mer Engine'

A DOS window will launch the MerMatch executable. Depending on the length of the DNA sequence, RAM and processor speed, the software will run for several minutes. Once it is finished, the masked DNA sequence will appear in the text window below.  Do not close this window.

Please proceed to the next section.