INTRODUCTION

PROBER is useful in designing DNA probes for determining genomic copy number in cells.

Genomic DNA sequences are retrieved from a server, masked for repetitive exact string matches in the human genome and analyzed for contiguously repeat free regions of sufficient aggregate length. These regions are then searched for optimized PCR forward and reverse primers, resulting in a collection of oligonucleotide probes. These probes are then be PCR amplified and purified, resulting in a collection of probes that we combine into a cocktail for FISH analysis.

Three easy steps are taken to create highly specific DNA probes. They are described in the order in which they are employed by the software application. The only requirement from the user are genomic start and stop coordinates and a human genome freeze.

PROGRAMS

DAS.DNA
Retrieves a human genomic DNA sequence 10-100kb in length from a Distributed Annotation Sever (DAS) server given coordinates and a freeze.

MER-MATCH
Masks repetitive areas of the DNA sequence with 'N' using a mermatch length with exact string matching to a mer dictionary genome database. In other words, a word length is matched against the human genome to identify repetitive elements in the DNA sequence for probe design.

TOLERANCE
Next, MerMatch will find the largest regions of contiguous good sequence based on cumulative sums and mark these regions with integers based on their size. The largest contigous DNA sequence that is repeat free is ranked with the lowest integer and the collection of regions are ordered for subsequent probe selection.

PROBER
Selects probes of 100-2000bp from the highest ranked non-repetitive DNA sequence first using distance matricies. PROBER scores all possible permutations of primers within a size range (15-30bp) and follow primer design guidelines to eliminate 'bad' primers. The optimal primers are selected based on probe size and matching melting temperatures. The final output includes a full report with a number of probe statistics and a short report containing only the forward and reverse primer sequences that may be used for ordering primers.

OUTPUT

The software outputs an image containing the location of each probe relative to the 20-100kb sequence. Two rounds of probe selection are indicated by 'Tiers' with minimal overlap in the genomic sequence that they cover. Repetitive areas are completely avoided for primer selection. The probes are identified by their ID on the upper portion of each rectangle and the probe length underneath. A percentage of genome coverage is also indicated in the upper right hand corner. If the PGC% is to low (for example < 20%) the probe selection can be repeated with less stringent parameters.

        

A text report can be saved containing specific information on each probe and primer pair including Primer length, Tm, Primer Sequence, Probe Sequence and Probe Length. In addition, a short report containing only the forward and reverse primer sequences in a seperate file can be saved to facillitate the ordering process.

::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
-TIER-1-PROBES:::::::[FULL PROBE REPORT]::::::::::::::::::::
::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
Probe ID 1
PrimerFseq :CTGTGCCGTTAACTCGAATG
PrimerRseq :GCACTCTCGAATGCGCCG
PrimerFseq Unmasked :CTGTGCCGTTAACTCGAATG
PrimerRseq Unmasked :CGGCGCATTCGAGAGTGC
PrimerF_length :20
PrimerR_length :18
PrimerF_loc :14758
PrimerR_loc :15756
PrimerF_tm :60
PrimerR_tm :60
Probe Length : 1016
Probe Sequence :
CTGTGCCGTTAACTCGAATGCTAGCCTGGTTAGGCGGGATTTCTCTGCTGGTAGAAATATGCCTTCTTCC
GTCTGCAAATTCCTGCAGCATCAGACAAACCCAGCCTACAATATTTAGACTGATTTTTACCAACTTAAT
GGCAGGGTCCATTTTGAAGGGGAAGCCAACAGTGTCTATGAGAGACGGGGTGGGGACGTTGGTGAA
AGAGAGGGGCTGAGGGTGGGTGAGTCGTATGTGCATCAAGTTTGGCCTCCAGTGAATCTTGGTCTAGA
ATGCTAGAGCCAGTGCTCCCACCCCTCAGTGCCCTGTCTGCTTCCTTACTGAGCAGGCTTGTAGGGCTTC
GTGAGATGAGGAGTCCCCTCCCCGTAGGGCTGCTGAGGGCTGAATGTGAAGTTCTTGGGTGGCCTGTG
TGGCTGGGATGAGTGGGCAT  

Please visit the 'tutorial' section to go through the steps required for designing oligo probes for a sample locus